uhrf1 grna  (Addgene inc)

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) Illustration of the developmental stages and specification timing of the 7 major retinal cell types: retinal ganglion cells, amacrine, horizontal, bipolar, Müller, cone, and rod photoreceptors. (B) Time course of Uhrf1 mRNA expression in the developing retina in wild-type mice. Levels of Uhrf1 mRNA were measured by RT-qPCR and normalized to the levels at E15.5 taken as 1 (n=3). Mean ± SD. (C) Representative Western blot analysis of UHRF1 protein levels with high and low exposure. Tubulin was used as loading control. (D) Quantification of the relative UHRF1 protein levels on Western blots, were E15.5 was taken as 1 (n=3). Mean ± SD.

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: Expressing, Quantitative RT-PCR, Western Blot, Control

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) Schematic diagram of conditional excision of the floxed Uhrf1 allele. (B) Western blot analysis of Uhrf1 expression in Uhrf1 cKO (Chx10- Cre Uhrf1 lox/lox ) and littermate control ( Uhrf1 lox/lox ) shows effective reduction of Uhrf1 protein upon Cre recombination of floxed Uhrf1 alleles. Actin was used as loading control. (C) RT-qPCR analysis of retinal cell marker genes. A significant increase in the mRNA level of Chx10 (bipolar), Prkca (bipolar) , Prox1 (amacrine/horizontal) and a significant decrease in rhodopsin (rods) transcription were observed in Uhrf1 cKO EGFP+ cells compared to the control littermates. All data are normalized to control littermates (n=4). *p<0.05 by unpaired two-tailed t test. (D-E) Representative images of P21 retina cross-sections (D) and dissociated cells (E) from Uhrf1 cKO Z/EG mice immunostained with recoverin (photoreceptors), cone-arrestin (cone photoreceptors), calbindin (horizontal and a subset of amacrine cells), chx10 (bipolar), and pkc-alpha (bipolar) antibodies (red). Retinae were double immunostained with anti-GFP to capture areas of Chx10-Cre -mediated GFP expression. Nuclei were counterstained with DAPI (blue). ONL, outer nuclear layer; INL, inner nuclear layer; GCL ganglion cell layer; ipl, inner plexiform layer; opl, outer plexiform layer. (F) Quantification of the proportion of immunoreactive cells for each cellular marker antibody shown in E and supplemental figure 3 was determined for EGFP+ and EGFP-cells from Uhrf1 cKO Z/EG mice from independent litters (n=3). Each bar represents the mean ± SD of 500 cells scored from each retina. (G-H) ERGs were recorded from 5-week-old Uhrf1 cKO (red line) and littermate control (black line). a-wave amplitude (G) and b-wave amplitude (H) were recorded at various light intensities. All measurements are mean ± SD (n=4).

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Marker, Two Tailed Test

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A-B) Uhrf1 protein level in P21 retinae and retinoblastoma tumor samples were compared to littermate controls (wt). Tubulin was used as loading control. (C) Chromatin immunoprecipitation (ChIP) assay in P0 mouse retinae and Weri retinoblastoma human cell line reveals enrichment of E2f1 within the Uhrf1 promoter. (D-E) Western blot analysis of Uhrf1 protein level in different retinae development stages in Rb1 cKO mice and Rb1/Rbl1 cDKO. Tubulin was used as loading control. (F) Quantification of Uhrf1 protein expression in Rb/Rbl1 cDKO. (G) RT-qPCR analysis of Uhrf1 mRNA level in Rb1/Rbl1 cDKO. Uhrf1 mRNA level in E17.5 wt mouse was set as 1. (H) Representative sequencing tracks for the Uhrf1 locus show increased peaks at the promoter in P21 Rb1/Rbl1 DKO mouse retinal cells (EGFP+) compared to control retinal cells (EGFP-). The ATAC-Seq data have been normalized to take sequencing depth into account. All measurements are mean ± SD (n=3).

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: Control, Chromatin Immunoprecipitation, Western Blot, Expressing, Quantitative RT-PCR, Sequencing

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) Kaplan-Meier curves showing the percentage of mice free of visible retinoblastoma tumors in Rb1/Rbl1 DKO (n=52) and Rb1/Rbl1/Uhrf1 (n=41) mice. (B) Volcano plot of differentially expressed genes (DEGs) in Rb1/Rbl1/Uhrf1 TKO compared to Rb1/Rbl1 DKO P21 mouse retinae. (C-D) p-value ranking bar graph representing the ten most significant gene ontology (GO) biological processes for (C) upregulated genes and (D) downregulated genes in Rb1/Rbl1/Uhrf1 TKO compared with Rb1/Rbl1 DKO P21 retinae. (E) Genome-wide heatmap plot of chromatin accessibility peaks (ATAC-seq) from flow sorted EGFP-negative ( Cre -negative) Rb1/Rbl1/Uhrf1 and EGFP-positive Rb1/Rbl1 DKO and Rb1/Rbl1/Uhrf1 TKO P21 retina grouped by mean reads and by distance from the transcription starting site (TSS). Each row represents a gene ordered in descending accessibility mean reads. (F) Heat map of differentially methylated genes in Cre -positive Rb1/Rbl1/Uhrf1 , Rb1/Rbl1 DKO and Cre -negative Rb1/Rbl1/Uhrf1 TKO P21 retina. (G-H) Representative images of (G) P12 retina and (H) P21 retina cross-sections from Rb1/Rbl1 DKO and Rb1/Rbl1/Uhrf1 TKO mice labeled with EdU (proliferating cells; red). Nuclei were counterstained with DAPI (blue). (I-J) Quantification of the proportion of EdU positive cells in (I) P12 and (J) P21 Rb/Rbl1 cDKO and dissociated retina Each bar represents the mean ± SD of 500 cells scored from each retina. (n=3). *p<0.05, **p<0.01 by unpaired two-tailed t test.

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: Genome Wide, Methylation, Labeling, Two Tailed Test

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) p-value ranking bar graph representing the ten most significant cell types for downregulated genes in Rb1/Rbl1/Uhrf1 TKO compared with Rb1/Rbl1 DKO P21 retinae. (B) Gene Set Enrichment Analysis (GSEA) enrichment plot of the fetal eye microglia gene cluster from the RNA-seq data comparing Rb1/Rbl1/Uhrf1 TKO to Rb1/Rbl1 DKO P21 retinae. (C) Western blot analysis of Uhrf1 protein level in VC or Uhrf1 KO UCI-Rb-1. Actin was used as loading control. (D) Representative bioluminescent images from mice orthotopically implanted with VC or Uhrf1 KO UCI-Rb-1 cells at 2-weeks post sub-retinal injection. (E) Quantification of the percentage of mice presenting tumors at 2-weeks post implantation with either 150000 (150K) or 100000 (100K) cells in immune-competent mice. (F) Quantification of the final tumor weight at 2 weeks post implantation. (G) Schematic workflow of the immune flow analysis of retinoblastoma tumors derived from VC and Uhrf1 KO UCI-Rb-1 cells after 2 weeks post-implantation. (H-O) Quantification of the percentage of (H) live cells, (I) leukocytes, (J) microglia, (K) myeloid cells, (L) dendritic cells, (M) T-cell, (N) helper T cells, and (O) cytotoxic T cells. Lines represent median ± SD. VC shown in black dots (n=12) and Uhrf1 KO shown in red dots (n=8). For all graphs: ns=not significant, *p<0.05 by unpaired two-tailed t test.

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: RNA Sequencing, Western Blot, Control, Injection, Derivative Assay, Two Tailed Test

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) Gene Set Enrichment Analysis (GSEA) enrichment plot of gene ontology for biological process for positive regulation of chemokine production from the RNA-seq data comparing Rb1/Rbl1/Uhrf1 TKO to Rb1/Rbl1 DKO P21 retinae. (B) Chemokine immunoassay analysis from conditioned media from VC and Uhrf1 KO UCI-Rb-1 cells. (C) Quantification of the chemokines identified in B. (n=2 independent batches). mean ± SD *p<0.05 by unpaired two-tailed t test. (D) GSEA enrichment plot for the hallmark for TNF alpha signaling via NF-kB from the RNA-seq data comparing Rb1/Rbl1/Uhrf1 TKO to Rb1/Rbl1 DKO P21 retinae. (E) Western blot analysis of NF-kB family proteins level in VC and Uhrf1 KO UCI-Rb-1. Actin was used as loading control. (F) Schematic summary of the role of Uhrf1 in retinoblastomagenesis.

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: RNA Sequencing, Two Tailed Test, Western Blot, Control

Journal: Nature communications

Article Title: Recent evolution of a TET-controlled and DPPA3/STELLA-driven pathway of passive DNA demethylation in mammals.

doi: 10.1038/s41467-020-19603-1

Figure Lengend Snippet: Fig. 4 TET-dependent expression of DPPA3 alters UHRF1 localization and chromatin binding in naïve ESCs. a Localization of endogenous DPPA3-HALO in live ESCs counterstained with SiR-Hoechst (DNA). Representative result, n ≥4. Scale bar: 5 μm. b Volcano plot from DPPA3-FLAG pulldowns in ESCs. Dark gray dots: significantly enriched proteins. Red dots: proteins involved in DNA methylation regulation. Purple dots: proteins involved in nuclear transport. anti-FLAG antibody: n = 3 biological replicates, IgG control antibody: n = 3 biological replicates. Statistical significance determined by performing a Student’s t test with a permutation-based FDR of 0.05 and an additional constant S0 = 1. c FRAP analysis of endogenous UHRF1-GFP. Each genotype comprises the combined single-cell data from two independent clones acquired in two independent experiments. d Localization dynamics of endogenous UHRF1-GFP in response to Dppa3 induction in U1G/D3KO + pSBtet-D3 ESCs with confocal timelapse imaging over 8 h (10 min intervals). t = 0 corresponds to start of Dppa3 induction with doxycycline (+Dox). (top panel) Representative images of UHRF1-GFP and DNA (SiR-Hoechst stain) throughout confocal timelapse imaging. Scale bar: 5 μm. (middle panel) Nucleus to cytoplasm ratio (N/C ratio) of endogenous UHRF1-GFP signal. (bottom panel) Coefficient of variance (CV) of endogenous UHRF1-GFP intensity in the nucleus. (middle and bottom panel) N/C ratio and CV values: measurements in n > 200 single cells per time point (precise values can be found in the Source Data file), acquired at n = 16 separate positions. Curves represent fits of four parameter logistic (4PL) functions to the N/C ratio (pink line) and CV (green line) data. Live-cell imaging was repeated three times with similar results. In (c), the mean fluorescence intensity of n cells (indicated in the plots) at each timepoint are depicted as shaded dots. Error bars indicate mean ± SEM. Curves (solid lines) indicate double-exponential functions fitted to the FRAP data. In the boxplots in (d), darker horizontal lines within boxes represent median values. The limits of the boxes indicate upper and lower quartiles, and whiskers extend to the most extreme value within 1.5 x the interquartile range from each hinge. P-values based on Welch’s two-sided t test. Source data are provided as a Source Data file.

Article Snippet: For insertion of the HALO or eGFP coding sequence into the endogenous Dppa3 and Uhrf1 loci, respectively, Dppa3 and Uhrf1 specific gRNAs were cloned into SpCas9-hGem-T2A-Puromycin/gRNA vector, which is a modified version of SpCas9-T2A-Puromycin/gRNA vector (px459;172, Addgene plasmid #62988) similar to that described above.

Techniques: Expressing, Binding Assay, DNA Methylation Assay, Control, Clone Assay, Imaging, Staining, Live Cell Imaging

Journal: Nature communications

Article Title: Recent evolution of a TET-controlled and DPPA3/STELLA-driven pathway of passive DNA demethylation in mammals.

doi: 10.1038/s41467-020-19603-1

Figure Lengend Snippet: Fig. 6 DPPA3 binds nuclear UHRF1 with high affinity prompting its release from chromatin in naïve ESCs. a Overview of RICS and ccRICS. Confocal image series are acquired on a laser scanning confocal microscope, containing spatiotemporal fluorescence information on the microsecond and millisecond timescales. A spatial autocorrelation function (SACF) is calculated from the fluorescence image and fit to a diffusive model. The cross- correlation of intensity between two channels is used to estimate the co-occurrence of two fluorescent molecules in live cells. The mean cross-correlation of the fluctuations is calculated and shown in the 3D plot color-coded according to the correlation value. b–e Representative plots of the spatial cross- correlation function (SCCF) between the depicted fluorescent molecules in cells from each cell line measured: (b) wild-type (U1WT:D3WT) and (c) K85E/ R85E/R87E DPPA3 mutant (U1WT:D3KRR), and control ESCs expressing (d) free eGFP, free mScarlet (eGFP + mScarlet) and (e) an eGFP-mScarlet tandem fusion (eGFP-mScarlet). f, g Mobile fraction of (f) mScarlet and (g) eGFP species in the cell lines depicted in (b, c, and e) and in Uhrf1KO ESCs expressing free eGFP and wild-type DPPA3-mScarlet (U1KO:D3WT). The mobile fraction was derived from a two-component model fit of the autocorrelation function. Data are pooled from three (U1WT:D3WT, U1WT:D3KRR) or two (U1KO:D3WT, eGFP-mScar) independent experiments. h Mean cross-correlation values of mobile eGFP and mScarlet measured in the cell lines depicted in (b–e). The spatial lag in the x-dimension (sensitive to fast fluctuations) is indicated by ξ, and the spatial lag in the y-dimension (sensitive to slower fluctuations) is indicated by ψ. Data are pooled from two independent experiments. i Microscale thermophoresis measurements of UHRF1-eGFP binding to GST-DPPA3 WT (D3WT) or GST-DPPA3 1–60 (D31–60). Error bars indicate the mean ± SEM of n = 2 technical replicates from n = 4 independent experiments. In (f–h), each data point represents the measured and fit values from a single cell where n = number of cells measured (indicated in the plots). In the boxplots, darker horizontal lines within boxes represent median values. The limits of the boxes indicate the upper and lower quartiles; the whiskers extend to the most extreme value within 1.5 x the interquartile range from each hinge. Source data are provided as a Source Data file.

Article Snippet: For insertion of the HALO or eGFP coding sequence into the endogenous Dppa3 and Uhrf1 loci, respectively, Dppa3 and Uhrf1 specific gRNAs were cloned into SpCas9-hGem-T2A-Puromycin/gRNA vector, which is a modified version of SpCas9-T2A-Puromycin/gRNA vector (px459;172, Addgene plasmid #62988) similar to that described above.

Techniques: Microscopy, Mutagenesis, Control, Expressing, Derivative Assay, Microscale Thermophoresis, Binding Assay